HN Top Links - Popular Stories from Hacker News

6991.

Disturbing surveillance video shows moment CEO Brian Thompson was shot (dailymail.co.uk)

4 points by LinuxBender on Dec 4, 2024 | 0 comments

6992.

Mercedes-Benz tests solar paint it says could deliver 20k kms range a year (thedriven.io)

4 points by teractiveodular on Dec 4, 2024 | 0 comments

6993.

Belgian sex workers get unemployment, maternity leave, and health insurance (abc.net.au)

4 points by speckx on Dec 4, 2024 | 0 comments

6994.

Top tips for more pleasurable bottoming (sfaf.org)

4 points by mostlyatnight on Dec 5, 2024 | 0 comments

6995.

Riley Walz explaining how he found where murderer of United Healthcare CEO fled (twitter.com)

4 points by scapecast on Dec 5, 2024 | 0 comments

6996.

Science could solve some of biggest problems. Why aren't governments using it? (nature.com)

4 points by pseudolus on Dec 5, 2024 | 0 comments

6997.

A New Phone Scanner That Detects Spyware Has Found 7 Pegasus Infections (wired.com)

4 points by thunderbong on Dec 5, 2024 | 0 comments

6998.

Tailor – hold Alt to measure space around web elements (muffinman.io)

4 points by wonger_ on Dec 5, 2024 | 0 comments

6999.

Show HN: Roast my Spotify Wrapped 2024 (zkarimi.com)

4 points by zknowledge on Dec 5, 2024 | 0 comments

7000.

The true story behind the 'bison skull mountain' photo (bbc.com)

4 points by pseudolus on Dec 4, 2024 | 0 comments

7001.

Manufacturing Is a War Now (noahpinion.blog)

4 points by paulpauper on Dec 5, 2024 | 0 comments

7002.

Psychological Principles for Effective Web Design (designdrizzle.com)

4 points by stevesmith1385 on Dec 5, 2024 | 0 comments

7003.

Intel 18A node yields reportedly at a dismal 10% (notebookcheck.net)

4 points by ladyanita22 on Dec 5, 2024 | 0 comments

7004.

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA (english.elpais.com)

4 points by marban on Dec 5, 2024 | 0 comments

7005.

The emergence of LLM sympathy in our codebases (simonharris.co)

4 points by TheStagHeart on Dec 5, 2024 | 0 comments

7006.

You can't get more adversarial than PvP MMORPGs (wirepair.org)

4 points by todsacerdoti on Dec 5, 2024 | 0 comments

7007.

How to Live in a Collapsing Economy (youtube.com)

4 points by razodactyl on Dec 5, 2024 | 0 comments

7008.

Hugging Face CEO has concerns about Chinese open source AI models (techcrunch.com)

4 points by echelon on Dec 5, 2024 | 0 comments

7009.

A TRAP for Workers (2022) (pluralistic.net)

4 points by sundarurfriend on Dec 4, 2024 | 0 comments

7010.

I asked 15 LLMs a question about my novel (bulmash.com)

4 points by burgerguyg on Dec 4, 2024 | 0 comments

7011.

EU ordered TikTok to freeze and preserve all data linked to Romanian elections (ec.europa.eu)

4 points by Sami_Lehtinen on Dec 5, 2024 | 0 comments

7012.

In the Year 2525 (en.wikipedia.org)

4 points by sans_souse on Dec 5, 2024 | 0 comments

7013.

Why I became a Documentation Engineer (and what that even means) (passo.uno)

4 points by SerCe on Dec 5, 2024 | 0 comments

7014.

Show HN: OpenOrch – orchestrate AI models, microservices, containers, and more (github.com)

4 points by dobika on Dec 5, 2024 | 0 comments

7015.

Children's toys show insights of cultural adaptation in Little Ice Age Greenland (phys.org)

4 points by wglb on Dec 5, 2024 | 0 comments

7016.

Show HN: Neon Model Context Protocol Server (github.com)

4 points by davidgomes on Dec 4, 2024 | 0 comments

7017.

CosmOS: an AI operating system built for a universe of connected devices [video] (youtube.com)

4 points by mt_ on Dec 4, 2024 | 0 comments

7018.

AI-generated memes that roast your repo (greptile.com)

4 points by dakshgupta on Dec 4, 2024 | 0 comments

7019.

Show HN: A novel markup language for lists – Describe (github.com)

4 points by demon_of_reason on Dec 4, 2024 | 0 comments

7020.

Key leaders behind Google's NotebookLM are leaving to create their own startup (techcrunch.com)

4 points by croes on Dec 5, 2024 | 0 comments